732 possible circuit designs for a t flip flop a using a d flip flop b using a j k

A comparison of real and simulated designs for vibratory parts feeding

A comparison of real and simulated designs for vibratory parts feeding

Ngày tải lên : 03/01/2014, 19:15
... effects produced by the feeder’s gates as state transitions in a < /b> non-deterministic finite state automaton (NFA) In our experiments the states are the stable cylinder orientations that we enumerated ... Industrial parts for < /b> vibratory feeding and orienting Medium-sized parts are shown in the foreground and tall-sized parts are shown in the background industrial vibratory bowl and the parts it ... See http://www.research.digital.com/SRC/juno-2 [10] Jayaraman Krishnasamy, Mark J Jakiela, and Daniel E Whitney Mechanics of vibration-assisted entrapment with application to design In International...
  • 6
  • 599
  • 0
Don’t Be Taken for a Ride Guide to Auto Leasing pdf

Don’t Be Taken for a Ride Guide to Auto Leasing pdf

Ngày tải lên : 16/03/2014, 12:20
... Chase may also offer the plan GMAC calls it “Smart Buy” and has a < /b> separate rider that must be signed in addition to the base contract Ford’s contract is called a < /b> “Simple Interest Balloon Contract,” ... then added to and included in the monthly lease payment, is subject to rent/finance charges, which in turn are taxable It may be advantageous to you to obtain documentation from the leasing dealer ... will also decrease the likelihood that anyone will be able to take advantage of you If you take the time to read your entire contract, front and back, before you sign it, you will understand the...
  • 29
  • 503
  • 0
Proposal for a COUNCIL DIRECTIVE on a common system of financial transaction tax and amending Directive 2008/7/EC pot

Proposal for a COUNCIL DIRECTIVE on a common system of financial transaction tax and amending Directive 2008/7/EC pot

Ngày tải lên : 29/03/2014, 18:20
... crisis has led to debates at all levels about a < /b> possible < /b> additional tax on the financial sector and in particular a < /b> financial transactions tax (FTT) This debate stems from the desire to ensure the ... respect of financial transactions carried out by that branch Chapter II Chargeability, taxable amount and rates Article Chargeability of FTT EN The FTT shall become chargeable for < /b> each financial transaction ... It shall not affect the validity of the delegated acts already in force As soon as it adopts a < /b> delegated act, the Commission shall notify it to the Council A < /b> delegated act adopted pursuant to...
  • 31
  • 569
  • 0
BE GARAGE WISE - Don’t get taken for a ride when you take your car in for a service docx

BE GARAGE WISE - Don’t get taken for a ride when you take your car in for a service docx

Ngày tải lên : 30/03/2014, 10:20
... fails) The details on any new MOT certificate are correct and that it has been correctly stamped The service record book has been stamped with the garage’s stamp and that the relevant details of the ... www.oft.gov.uk The AA www.theaa.com Trading Standards Trading Standards services are provided by your local authority For < /b> contact details of your local department see your phone book or go to: ... Remember: the law says that any services you buy must be: carried out with reasonable care and skill; carried out within a < /b> reasonable time at a < /b> reasonable charge (if no charge is agreed in advance); and...
  • 14
  • 352
  • 0
Báo cáo hóa học: "Research Article Existence of Solutions for a Class of Weighted p t -Laplacian System Multipoint Boundary Value Problems" doc

Báo cáo hóa học: "Research Article Existence of Solutions for a Class of Weighted p t -Laplacian System Multipoint Boundary Value Problems" doc

Ngày tải lên : 22/06/2014, 03:20
... 2 Journal of Inequalities and Applications The study of differential equations and variational problems with variable exponent growth conditions is a < /b> new and interesting topic Many results have ... solution 18 Journal of Inequalities and Applications Acknowledgments This work is supported by the National Science Foundation of China 10701066 and 10671084 , China Postdoctoral Science Foundation ... βi 1− −1 t,< /b> w t < /b> a < /b> −1 a < /b> h t < /b> m−2 i αi h t < /b> dt dt − e1 2.14 Journal of Inequalities and Applications From Lemma 2.1, it is immediate that Λh a1< /b> − Λh a2< /b> , a1< /b> − a2< /b> > 0, for < /b> a1< /b> / a2< /b> , 2.15 and hence,...
  • 18
  • 222
  • 0
Báo cáo toán học: "On the possible orders of a basis for a finite cyclic group" potx

Báo cáo toán học: "On the possible orders of a basis for a finite cyclic group" potx

Ngày tải lên : 08/08/2014, 12:22
... n /a1< /b> ) such that bb (mod n /a1< /b> ) Let A< /b> := {0, a< /b> , b } This set can be considered as a < /b> basis for < /b> Zn /a1< /b> , and the latter can be naturally identified with the subring of Zn consisting of the ... and is denoted by γ (D)< /b> A < /b> related notion is the diameter diam (D)< /b> , defined to be the maximum, over all x, y ∈ V , of the shortest path (walk) from x to y, this taken to be ∞ if some pair of vertices ... First suppose that at least one of a,< /b> b and ba < /b> is a < /b> unit in Zn (we will see later that the general case can essentially be reduced to this one) By Lemma 3.1 again, we may assume without loss...
  • 10
  • 354
  • 0
Báo cáo y học: "Diacerein inhibits the synthesis of resorptive enzymes and reduces osteoclastic differentiation/survival in osteoarthritic subchondral bone: a possible mechanism for a protective effect against subchondral bone remodelling" ppsx

Báo cáo y học: "Diacerein inhibits the synthesis of resorptive enzymes and reduces osteoclastic differentiation/survival in osteoarthritic subchondral bone: a possible mechanism for a protective effect against subchondral bone remodelling" ppsx

Ngày tải lên : 09/08/2014, 10:23
... analysis and interpretation of data, and manuscript preparation JM-P participated in study design, analysis and interpretation of data, manuscript preparation, and statistical analysis SKT participated ... Authors' contributions CB participated in study design, acquisition of data, analysis and interpretation of data, manuscript preparation, and statistical analysis J- PP participated in study design, ... participated in acquisition of data, analysis and interpretation of data, and manuscript preparation SC participated in acquisition of data and manuscript preparation All authors read and approved...
  • 10
  • 536
  • 0
Green Energy and Technology - Energy for a Warming World Part 7 pps

Green Energy and Technology - Energy for a Warming World Part 7 pps

Ngày tải lên : 09/08/2014, 11:20
... absorbed by the reactor in the form of heat; and third, heat is produced by the radioactive decay of fission products and materials that have been activated by neutron absorption This heat associated ... amount of charge that has to be transferred from the positive plate to the negative plate, through the battery, to achieve this steady state is the product of the voltage and the charge storage ... balance between demand, battery capacity, and available charging power If the circuit < /b> is large and there are enough chargers and rechargeable batteries, and if the load variation and the clockwork mechanisms...
  • 19
  • 394
  • 0
Rising Above the Gathering Storm Energizing and Employing America for a Brighter Economic Future phần 7 pdf

Rising Above the Gathering Storm Energizing and Employing America for a Brighter Economic Future phần 7 pdf

Ngày tải lên : 09/08/2014, 23:20
... Student Aspirations Stanford, CA: The Bridge Project, Stanford University, 2003 Available at: http://www.stanford.edu/ group/bridgeproject/betrayingthecollegedream.pdf 9E Babco Trends in African American ... entrants.2 Can the United States afford to turn away talented students interested in these fields? Some argue more broadly that all college students should gain an awareness, understanding, and ... National Science Foundation, 2003 Table Data from National Center for < /b> Education Statistics, Integrated Postsecondary Education Data System Completions Survey and National Science Foundation/ Division...
  • 58
  • 326
  • 0
Feedback.Control.for.a.Path.Following.Robotic.Car Part 7 pptx

Feedback.Control.for.a.Path.Following.Robotic.Car Part 7 pptx

Ngày tải lên : 10/08/2014, 02:20
... signal between the desired and actual number of encoder counts, and ki , kp , and kd are gains that should be chosen for < /b> the best system performance and stability Because the system is operating ... connected to the car’s rear axle An optical emitter/detector pair is placed on either side of the disk The slits in the disk allow light from the emitter to reach the detector causing the detector ... beneath the car The camera provides path information about the area in front of the car The IR, magnetic, and camera sensors are used for < /b> lateral control, i.e to determine how to steer the car...
  • 10
  • 336
  • 0
Báo cáo y học: " A polymorphism in the interleukin-4 receptor affects the ability of interleukin-4 to regulate Th17 cells: a possible immunoregulatory mechanism for genetic control of the severity of rheumatoid arthritis" doc

Báo cáo y học: " A polymorphism in the interleukin-4 receptor affects the ability of interleukin-4 to regulate Th17 cells: a possible immunoregulatory mechanism for genetic control of the severity of rheumatoid arthritis" doc

Ngày tải lên : 12/08/2014, 15:22
... Yanagihara Y, Mao XQ, Gao PS, Arinobu Y, Ihara K, Takabayashi A,< /b> Hara T,< /b> Enomoto T,< /b> Sasaki S, Kawai M, Hamasaki N, Shirakawa T,< /b> Hopkin JM, Izuhara K: Cutting edge: dominant effect of Ile50Val ... methods and data collection MJL performed ELISA assays and flow cytometry JR performed ELISA assays and flow cytometry ES contributed to study design and performed statistical analysis DF directed ... supported by grants from the Arthritis Foundation and by National Institute of Arthritis and Musculoskeletal and Skin Diseases grant AR38477 Authors’ contributions SW participated in study design,...
  • 9
  • 472
  • 0
Báo cáo y học: "Recently published papers: Clunk-click every trip, smile, but don’t stop for a drink on the way" ppt

Báo cáo y học: "Recently published papers: Clunk-click every trip, smile, but don’t stop for a drink on the way" ppt

Ngày tải lên : 12/08/2014, 20:20
... compared standard therapy alone with standard therapy plus a < /b> maximum of four intratracheal doses of a < /b> recombinant surfactant protein C-based surfactant given within 24 hours They failed to demonstrate ... cirrhotic patients is related to the severity of their underlying liver disease, or that of the acute illness that precipitated admission Their retrospective analysis compared clinical and laboratory ... demonstrate any difference between control and treatment groups with regard to mortality or need for < /b> mechanical ventilation Those in the surfactant group had significantly greater arterial oxygen tension...
  • 3
  • 317
  • 0
Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot

Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot

Ngày tải lên : 13/08/2014, 01:20
... aorta ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt BDLvsVIR CD8 -1.3 -2.2 ATP6V 1D < /b> NM_015994.2 ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D < /b> ATP6V1DL ttttcactagctgaagccaagtt ... gtgggagaatggctctgc KLRD1R tttgtattaaaagtttcaaatgatgga BDLvsLTNP CD8 2.5 2.1 IRS2 NM_003749.2 insulin receptor substrate IRS2L tgacttcttgtcccaccactt IRS2R catcctggtgataaagccaga CD8 3.8 2.7 BDLvsVIR ... ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt VIRvsLTNP CD8 4.3 2.8 PSMB2 NM_002794.3 proteasome subunit, beta type, PSMB2L agagggcagtggaactcctt PSMB2R gaaggttggcagattcagga VIRvsLTNP CD8 1.3...
  • 21
  • 376
  • 0
Báo cáo y học: " CD45 immunoaffinity depletion of vesicles from Jurkat T cells demonstrates that exosomes contain CD45: no evidence for a distinct exosome/HIV-1 budding pathway" doc

Báo cáo y học: " CD45 immunoaffinity depletion of vesicles from Jurkat T cells demonstrates that exosomes contain CD45: no evidence for a distinct exosome/HIV-1 budding pathway" doc

Ngày tải lên : 13/08/2014, 05:21
... samples had somewhat less intense staining CA bands than the untreated material Similarly, the bead fractions had CA signal, though at a < /b> lower intensity than either the treated or untreated samples, ... has not been observed It is important to note that, absolute biochemical purity of virion preparations may not be practically attainable and analyses should be evaluated with this important caveat ... the beads and analyzed Pan-specific CD45 antibody was obtained from BD-Transduction Laboratories, San Diego, CA, cat # 610266, Clone 69, IgG1 The pan-actin antibody was obtained from Amersham Biosciences,...
  • 5
  • 221
  • 0
Báo cáo y học: "Human cyclin T1 expression ameliorates a T-cell-specific transcriptional limitation for HIV in transgenic rats, but is not sufficient for a spreading infection of prototypic R5 " ppt

Báo cáo y học: "Human cyclin T1 expression ameliorates a T-cell-specific transcriptional limitation for HIV in transgenic rats, but is not sufficient for a spreading infection of prototypic R5 " ppt

Ngày tải lên : 13/08/2014, 05:21
... GCT TAT TTG, 3'-primer: CAG ATA GTC ACT ATA AGG ACG AAC) and selected for < /b> further matings with n-tg Sprague-Dawley rats Transgene expression in progeny was demonstrated by western blot detection ... MAG and OTK designed the study and interpreted the data KG and IA provided technical support VNKR and DRL provided the pMΦE 4A.< /b> CyclinT1 tg vector and gave input on the manuscript MS gave input ... or absence of expression plasmids encoding for < /b> HIV-1 Tat and HIV-2 Tat, respectively, and analyzed by flow cytometry one day later The basal, Tat-independent LTR activity was comparable for < /b> both...
  • 19
  • 263
  • 0
Báo cáo y học: "High-molecular-weight hyaluronan – a possible new treatment for sepsis-induced lung injury: a preclinical study in mechanically ventilated rats" ppsx

Báo cáo y học: "High-molecular-weight hyaluronan – a possible new treatment for sepsis-induced lung injury: a preclinical study in mechanically ventilated rats" ppsx

Ngày tải lên : 13/08/2014, 11:22
... experimental design, and assisted in the data analysis and interpretation DAQ is the principal investigator who initiated the project, designed the experiments, and oversaw the interpretation of the data ... infiltration induced by mechanical ventilation Rats receiving LPS had increased BAL neutrophils as compared with rats without LPS treatment Pretreatment with HMW HA (1,600 kDa) decreased BAL neutrophils ... USA) was inserted into the trachea and connected to a < /b> Harvard apparatus ventilator (model 55-7058; Harvard Apparatus, Holliston, MA, USA) The rats were then ventilated Page of 11 (page number...
  • 11
  • 297
  • 0
Báo cáo sinh học: "The power of two experimental designs for detecting linkage between a marker locus and a locus affecting a quantitative character in a segregating population" pptx

Báo cáo sinh học: "The power of two experimental designs for detecting linkage between a marker locus and a locus affecting a quantitative character in a segregating population" pptx

Ngày tải lên : 14/08/2014, 19:22
... and dominant effect (a < /b> and d)< /b> can be solved as: and the additive and dominance effects at the QTL are obtained from: Once the design parameters (s and n) and the genetic parameters at the QLT and ... parameters by using < /b> linkage between a < /b> locus underlying a < /b> quantitative trait and a < /b> marker locus Heredity 70, 245-253 Patnaitk PB (1949) The noncentral X and F-distributions and their applications ... investigation of the genetical basis of quantitative characters has become a < /b> subject of considerable activity (Botstein et al, 1980; Beckmann and Soller, 1986; Lander and Botstein, 1989) The central...
  • 13
  • 278
  • 0
Tmb.Âm nhạc  7 - theo chuẩn mới nhất của Bộ GD - mẫu soạn của nhạc sĩ Hoàng Long

Tmb.Âm nhạc 7 - theo chuẩn mới nhất của Bộ GD - mẫu soạn của nhạc sĩ Hoàng Long

Ngày tải lên : 05/02/2015, 07:00
... x t < /b> ti t < /b> học ƠN T< /b> P B I H T:< /b> KHÚC H T < /b> CHIM SƠN CA T< /b> P ĐỌC NHẠC : T< /b> N SỐ ANTT: GIỚI THIỆU NHẠC SĨ B T-< /b> TƠ-VEN I Mục tiêu: Kiến thức - HS h t < /b> thuộc h t < /b> Khúc h t < /b> chim sơn ca, h t < /b> giai điệu, lời ca,thể ... Mục Tiêu: Kiến thức: - HS thuộc h t < /b> “Khúc Ca B n M a< /b> Nắm nội dung h t < /b> - HS bi t < /b> TĐN Q hương d< /b> n ca U-crai-na K năng: - HS h t < /b> giai điệu, lời ca, thể sắc thái h t < /b> Trình b y h t < /b> theo hình thức: ... phương T< /b> y mà em bi t?< /b> nghĩ trả lời Kiểm tra: - GV tiến hành kiểm tra sau ti t < /b> HS ơn GV u cầu kiến thức học - Hình thức kiểm tra: Kiểm tra thực hành HS kiểm - HS phép chọn nhóm , chọn h t < /b> trước tra...
  • 83
  • 539
  • 0
Identification and characterization of a novel heart  reactive autoantibody in systemic lupus erythematosus possible serological marker for early myocardial dysfunction

Identification and characterization of a novel heart reactive autoantibody in systemic lupus erythematosus possible serological marker for early myocardial dysfunction

Ngày tải lên : 14/09/2015, 12:42
... anticholesterol antibody aCL anticardiolipin antibodies ANA antinuclear autoantibody ANP atrial natriuretic peptide APS anti-phospholipid syndrome aPL anti-phospholipids antibodies ARA American Rheumatology ... of additional antibodies against 60 kDa 14 Introduction Ro These purified antibodies consistently recognized EBNA-1, but not other autoantigens or dsDNA In addition, they did not bind to antigens ... Anti-cTnI positivity was found to correlate with myocardial dysfunction as shown by reduced early diastolic longitudinal strain rates I postulate that the formation of anti-cTnI antibody is the...
  • 183
  • 327
  • 0
CRH BP as a possible diagnostic marker for hepatocellular carcinoma

CRH BP as a possible diagnostic marker for hepatocellular carcinoma

Ngày tải lên : 04/10/2015, 08:00
... islands Product size (bp) 128 Primer CRH-BP-MF CRH-BP-MR Sequence 5' ACGGTTTTAAGAGGGGAAAGTC 3' 5' ACGAACCCCAAAAAACTACG 3' CRH-BP-UF CRH-BP-UR 5' GATGGTTTTAAGAGGGGAAAGTT 3' 5' AACAAACCCCAAAAAACTACA ... ATGACCAGTCAACAGGGGAC 3’ 5’ CCAGCAAGCTTGCGACCTTGACCA 3’ 192 GW-CRH-BP-f 5’ AAA AAG CAG GCT CCA GCA TGT CGC CCA ACT TC 3’ GW-CRH-BP-r 5’ AGA AAG CTG GGT AAA GAC CAG ACA AAC AGA ATT C 3’ - Table Oligonucleotide ... AACAAACCCCAAAAAACTACA 3' 128 CRH-BP-f CRH-BP-r 5’ CCAGCATGTCGCCCAACTT 3’ 5’ CCTATTCCCTCGCAACCTG 3’ 700 GAPDH-f GAPDH-r 5’ ACCACAGTCCATGCCATCA 3’ 5’ TCCACCACCCTGTTGCTGTA 3’ 453 HPRT1-f HPRT1-r 5’ ATGACCAGTCAACAGGGGAC...
  • 103
  • 273
  • 0

Xem thêm